ID: 1062436862_1062436867

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1062436862 1062436867
Species Human (GRCh38) Human (GRCh38)
Location 9:136550236-136550258 9:136550274-136550296
Sequence CCAGAGGCTCCGGAAGGTTTGCT GCAAGAAGCTGAAGGAATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 163} {0: 1, 1: 0, 2: 1, 3: 26, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!