ID: 1062436863_1062436866

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1062436863 1062436866
Species Human (GRCh38) Human (GRCh38)
Location 9:136550245-136550267 9:136550273-136550295
Sequence CCGGAAGGTTTGCTGACTGACCT TGCAAGAAGCTGAAGGAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 119} {0: 1, 1: 0, 2: 4, 3: 35, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!