ID: 1062451202_1062451210

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1062451202 1062451210
Species Human (GRCh38) Human (GRCh38)
Location 9:136616511-136616533 9:136616542-136616564
Sequence CCGTGTGAGGGGCTGGCCTGGCT CAGGCACGTGAGGCTGCATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 24, 4: 293} {0: 1, 1: 0, 2: 1, 3: 24, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!