ID: 1062478596_1062478607

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1062478596 1062478607
Species Human (GRCh38) Human (GRCh38)
Location 9:136741449-136741471 9:136741462-136741484
Sequence CCCGCCCCTGCTCCCGTGGGACC CCGTGGGACCCGGGAAGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 413} {0: 1, 1: 0, 2: 1, 3: 6, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!