ID: 1062494429_1062494436

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1062494429 1062494436
Species Human (GRCh38) Human (GRCh38)
Location 9:136825117-136825139 9:136825138-136825160
Sequence CCAGCAGGCCCAGCTGCGATGGT GTGCGGTGTGAGGCAGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!