ID: 1062494429_1062494437

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1062494429 1062494437
Species Human (GRCh38) Human (GRCh38)
Location 9:136825117-136825139 9:136825139-136825161
Sequence CCAGCAGGCCCAGCTGCGATGGT TGCGGTGTGAGGCAGGCCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!