ID: 1062494879_1062494893

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1062494879 1062494893
Species Human (GRCh38) Human (GRCh38)
Location 9:136826998-136827020 9:136827025-136827047
Sequence CCCCTTCCTGGTGGCCTGCTGTG GGGCTGGTGTGGAGGCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 39, 4: 333} {0: 1, 1: 0, 2: 6, 3: 55, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!