ID: 1062497839_1062497846

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1062497839 1062497846
Species Human (GRCh38) Human (GRCh38)
Location 9:136839946-136839968 9:136839981-136840003
Sequence CCGGGGTCCTCTCCTGAGTCCAG TGCTCCTGGCAGCCCCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 349} {0: 1, 1: 0, 2: 6, 3: 40, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!