ID: 1062497842_1062497846

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1062497842 1062497846
Species Human (GRCh38) Human (GRCh38)
Location 9:136839958-136839980 9:136839981-136840003
Sequence CCTGAGTCCAGGATGCTGTGCCA TGCTCCTGGCAGCCCCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 230} {0: 1, 1: 0, 2: 6, 3: 40, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!