ID: 1062500622_1062500633

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1062500622 1062500633
Species Human (GRCh38) Human (GRCh38)
Location 9:136850496-136850518 9:136850539-136850561
Sequence CCACCAGCAGATGAGACCCACGT GGCCCCAGGATCCACCATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 93} {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!