ID: 1062516709_1062516728

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1062516709 1062516728
Species Human (GRCh38) Human (GRCh38)
Location 9:136940569-136940591 9:136940617-136940639
Sequence CCACTGGGCCACCGTCCAGGGCC GGGCCGAGGCCAGCTGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 275} {0: 1, 1: 0, 2: 8, 3: 58, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!