ID: 1062520229_1062520250

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1062520229 1062520250
Species Human (GRCh38) Human (GRCh38)
Location 9:136954594-136954616 9:136954647-136954669
Sequence CCTGTCCTGGGCTACCTCCTCCC TCCCTCTGGGTCCCCTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 61, 4: 428} {0: 1, 1: 0, 2: 1, 3: 39, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!