ID: 1062520241_1062520250

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1062520241 1062520250
Species Human (GRCh38) Human (GRCh38)
Location 9:136954626-136954648 9:136954647-136954669
Sequence CCCCTGTCCCGGGCCATCTCCTC TCCCTCTGGGTCCCCTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 490} {0: 1, 1: 0, 2: 1, 3: 39, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!