ID: 1062532408_1062532419

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1062532408 1062532419
Species Human (GRCh38) Human (GRCh38)
Location 9:137007717-137007739 9:137007761-137007783
Sequence CCGGGTCAGCCTTTGGCACAATT CACAGGGCATGGCCGAGTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 108} {0: 1, 1: 0, 2: 2, 3: 29, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!