ID: 1062558969_1062558981

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1062558969 1062558981
Species Human (GRCh38) Human (GRCh38)
Location 9:137130593-137130615 9:137130633-137130655
Sequence CCTGCCCCTTGGGCGATTCTGCT CTGTGGCATTTCTGGGTGTTTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 39, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!