ID: 1062561049_1062561059

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1062561049 1062561059
Species Human (GRCh38) Human (GRCh38)
Location 9:137142064-137142086 9:137142092-137142114
Sequence CCCACCCCTGTCTCCTACACAGC TCTACCGCATACCCGTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 589} {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!