ID: 1062561951_1062561964

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1062561951 1062561964
Species Human (GRCh38) Human (GRCh38)
Location 9:137145636-137145658 9:137145658-137145680
Sequence CCTCCGGCGGGTGTTCCGGCAGT TGGGAGGCGGGTGGGAGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 26} {0: 1, 1: 0, 2: 7, 3: 180, 4: 1850}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!