ID: 1062567319_1062567335

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1062567319 1062567335
Species Human (GRCh38) Human (GRCh38)
Location 9:137169001-137169023 9:137169054-137169076
Sequence CCCAGAGCCCAGCGCCAGGCAGG CGAGCGTGTAAACCACGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 62, 4: 440} {0: 1, 1: 0, 2: 0, 3: 3, 4: 21}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!