ID: 1062567786_1062567800

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1062567786 1062567800
Species Human (GRCh38) Human (GRCh38)
Location 9:137170964-137170986 9:137170985-137171007
Sequence CCCTCAGCCCTCTACTCAGGTGG GGTAGGGGCGGGGGTGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 172} {0: 1, 1: 1, 2: 51, 3: 783, 4: 6356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!