ID: 1062570339_1062570351

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1062570339 1062570351
Species Human (GRCh38) Human (GRCh38)
Location 9:137182082-137182104 9:137182134-137182156
Sequence CCTGCGCACCTGCAATCCCAGCA CCCAGGTGTCCGAGGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 123, 4: 420} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!