ID: 1062572473_1062572483

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1062572473 1062572483
Species Human (GRCh38) Human (GRCh38)
Location 9:137191952-137191974 9:137191977-137191999
Sequence CCGATGGCAGGAGGCACCCTAGC CTTCCAGGGCCAGGAGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145} {0: 1, 1: 0, 2: 3, 3: 45, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!