ID: 1062574472_1062574484

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1062574472 1062574484
Species Human (GRCh38) Human (GRCh38)
Location 9:137199981-137200003 9:137200009-137200031
Sequence CCAGGCGGGGAGCCCGCGAGGCG CAGGGCCGGCCCGGGGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 153} {0: 1, 1: 0, 2: 4, 3: 37, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!