ID: 1062574487_1062574500

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1062574487 1062574500
Species Human (GRCh38) Human (GRCh38)
Location 9:137200018-137200040 9:137200064-137200086
Sequence CCCGGGGCTCAGGGGCCGAGTGC CGCGCCGCGGTGCAGACCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 264} {0: 1, 1: 0, 2: 1, 3: 9, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!