ID: 1062574488_1062574496

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1062574488 1062574496
Species Human (GRCh38) Human (GRCh38)
Location 9:137200019-137200041 9:137200051-137200073
Sequence CCGGGGCTCAGGGGCCGAGTGCC GCAGGCGGGCGCCCGCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 239} {0: 1, 1: 0, 2: 2, 3: 17, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!