ID: 1062578370_1062578383

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1062578370 1062578383
Species Human (GRCh38) Human (GRCh38)
Location 9:137218873-137218895 9:137218922-137218944
Sequence CCAGCCCAGCAGGAAAGTCTGTG GACGGGCACCGTACTGGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 234} {0: 1, 1: 0, 2: 1, 3: 6, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!