ID: 1062579054_1062579062

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1062579054 1062579062
Species Human (GRCh38) Human (GRCh38)
Location 9:137221621-137221643 9:137221650-137221672
Sequence CCCATGGCTCCAGGACAGGGCGC AAGGCAGCTAGCCGAAGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 141} {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!