ID: 1062579054_1062579068

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1062579054 1062579068
Species Human (GRCh38) Human (GRCh38)
Location 9:137221621-137221643 9:137221667-137221689
Sequence CCCATGGCTCCAGGACAGGGCGC CGCTGGCTGCAGGAGGACCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 141} {0: 1, 1: 0, 2: 2, 3: 20, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!