ID: 1062587090_1062587102

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1062587090 1062587102
Species Human (GRCh38) Human (GRCh38)
Location 9:137254314-137254336 9:137254362-137254384
Sequence CCCTCGCCCTAGGGCTGACCAAC TAGCCATGGCCTTGGGAGCTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!