ID: 1062591976_1062591997

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1062591976 1062591997
Species Human (GRCh38) Human (GRCh38)
Location 9:137278392-137278414 9:137278444-137278466
Sequence CCTCAAGGCCCGCGGCCGTTTAT CCTGCGGAGGGGCGGAGGGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 90, 4: 834}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!