ID: 1062600311_1062600317

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1062600311 1062600317
Species Human (GRCh38) Human (GRCh38)
Location 9:137316271-137316293 9:137316301-137316323
Sequence CCGGCGGAGATTCAAAAGCTAAC CGCCCGCGGCCTTCGCGCGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!