ID: 1062611451_1062611460

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1062611451 1062611460
Species Human (GRCh38) Human (GRCh38)
Location 9:137376384-137376406 9:137376426-137376448
Sequence CCTTCCACCTCCTGTTCACCAGA TCATCTATCCATGTGCTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 417} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!