ID: 1062623179_1062623191

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1062623179 1062623191
Species Human (GRCh38) Human (GRCh38)
Location 9:137431663-137431685 9:137431700-137431722
Sequence CCAGGAGTGACCCAGCTGGGGAC ACAGCTCTGGAGGGGCCCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 27, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!