ID: 1062631970_1062631982

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1062631970 1062631982
Species Human (GRCh38) Human (GRCh38)
Location 9:137467126-137467148 9:137467173-137467195
Sequence CCAACCTGCATCTGTGCCTTCTC CTGCACTGGGAGGCTTCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 399} {0: 1, 1: 0, 2: 0, 3: 20, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!