ID: 1062636696_1062636705

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1062636696 1062636705
Species Human (GRCh38) Human (GRCh38)
Location 9:137495204-137495226 9:137495248-137495270
Sequence CCTGTCCCTGACAGCCTCCGGTG ACCCCATCCACACCGCAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 673} {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!