ID: 1062650571_1062650579

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1062650571 1062650579
Species Human (GRCh38) Human (GRCh38)
Location 9:137574735-137574757 9:137574760-137574782
Sequence CCAAGCCTGGCCCTTACCTTCCA TTTCCCAGTGGACCAATCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 487} {0: 1, 1: 0, 2: 2, 3: 11, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!