ID: 1062653428_1062653452

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1062653428 1062653452
Species Human (GRCh38) Human (GRCh38)
Location 9:137590124-137590146 9:137590168-137590190
Sequence CCCGGCCGCCGCCCGCACAACCG CTGGACGGGCGAGACGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 170} {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!