ID: 1062674951_1062674955 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1062674951 | 1062674955 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 9:137736863-137736885 | 9:137736905-137736927 |
| Sequence | CCTGGGTGACAGAGTGAGCCTGT | ATATATACAGAGATTTGGCTGGG |
| Strand | - | + |
| Off-target summary | {0: 9, 1: 1473, 2: 14966, 3: 56111, 4: 114711} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||