ID: 1062674952_1062674955 |
View in Genome Browser |
Spacer: 1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1062674952 | 1062674955 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 9:137736881-137736903 | 9:137736905-137736927 |
| Sequence | CCTGTGTCTCAAAAAAAAAGAAA | ATATATACAGAGATTTGGCTGGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 50, 2: 912, 3: 4964, 4: 32012} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||