ID: 1062696184_1062696195

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1062696184 1062696195
Species Human (GRCh38) Human (GRCh38)
Location 9:137877595-137877617 9:137877609-137877631
Sequence CCTGGGCCCGGCCCAGCCCCGGG AGCCCCGGGGTGGGAGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 187, 4: 1438} {0: 1, 1: 0, 2: 7, 3: 52, 4: 520}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!