ID: 1062711208_1062711217

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1062711208 1062711217
Species Human (GRCh38) Human (GRCh38)
Location 9:137976092-137976114 9:137976143-137976165
Sequence CCATGCCCAGTGTGGGCTGGGGT GCCTGAAGACAGTGAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 386} {0: 1, 1: 0, 2: 4, 3: 36, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!