ID: 1062715924_1062715933

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1062715924 1062715933
Species Human (GRCh38) Human (GRCh38)
Location 9:138010055-138010077 9:138010074-138010096
Sequence CCAACGCCCAAGAGCTGACCAAG CAAGGTAGGTGGCGACAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 103} {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!