ID: 1062718669_1062718685

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1062718669 1062718685
Species Human (GRCh38) Human (GRCh38)
Location 9:138023592-138023614 9:138023636-138023658
Sequence CCAAGGGCGAGCGGCGCGCGCGG GGGCCCCGGGAGGCGGAGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 147} {0: 1, 1: 0, 2: 6, 3: 77, 4: 701}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!