ID: 1062723838_1062723843

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1062723838 1062723843
Species Human (GRCh38) Human (GRCh38)
Location 9:138059829-138059851 9:138059847-138059869
Sequence CCTCTTCCTGGGTTCCGCAGAAC AGAACCCCCTGGACATGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161} {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!