ID: 1062776085_1062776092

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1062776085 1062776092
Species Human (GRCh38) Human (GRCh38)
Location 10:149231-149253 10:149260-149282
Sequence CCATCCCTGCACTGTGGCCTGGG TGTGAGGCAGAACACTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 9, 3: 145, 4: 1190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!