ID: 1062776087_1062776092

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1062776087 1062776092
Species Human (GRCh38) Human (GRCh38)
Location 10:149235-149257 10:149260-149282
Sequence CCCTGCACTGTGGCCTGGGAATT TGTGAGGCAGAACACTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 46, 4: 335} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!