ID: 1062826349_1062826356

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1062826349 1062826356
Species Human (GRCh38) Human (GRCh38)
Location 10:571554-571576 10:571593-571615
Sequence CCTTCCTCACTGCACTTCCCCAT ATTCTCAGTCAGGTCAGTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!