ID: 1062829064_1062829078

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1062829064 1062829078
Species Human (GRCh38) Human (GRCh38)
Location 10:593413-593435 10:593461-593483
Sequence CCTCACCCCCGCTGTCTCCCAGC GCCGCCCTGCTCTGCCCACGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 61, 4: 572} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!