ID: 1062841153_1062841167

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1062841153 1062841167
Species Human (GRCh38) Human (GRCh38)
Location 10:673036-673058 10:673080-673102
Sequence CCTGTACCTGGTTAGAACCAAGG GGCCTTGCTGCTCAGCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!