ID: 1062882186_1062882199

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1062882186 1062882199
Species Human (GRCh38) Human (GRCh38)
Location 10:988081-988103 10:988115-988137
Sequence CCTAAGCCCCGCAACTCCCAAAT GGACCCTCCAACCCTGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158} {0: 1, 1: 0, 2: 1, 3: 141, 4: 959}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!