ID: 1062905000_1062905010

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1062905000 1062905010
Species Human (GRCh38) Human (GRCh38)
Location 10:1173905-1173927 10:1173955-1173977
Sequence CCTACCGAGCTGACCATGAGGTT CTGGGGGCCCGCAATGCTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!